View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_187 (Length: 235)
Name: NF1343_low_187
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_187 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 52288550 - 52288701
Alignment:
| Q |
1 |
atatagaactcgatggttaaccttgtaagaaggtaaatatttttaaaacaaaattcatttaacagtgaactacaattatctatgttagcagaagagattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52288550 |
atatagaactcgatggttaaccttgtaagaaggtaaatatttttaaaacaaaattcatttaacagtgaactacaattatctattttagcagaagagattg |
52288649 |
T |
 |
| Q |
101 |
gaaagaagacaggaatctgtgggcagtaaatagagtatttgtcgagtataat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52288650 |
gaaagaagacaggaatctgtgggcagtaaatagagtatttgtcgagcataat |
52288701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University