View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_low_189 (Length: 228)

Name: NF1343_low_189
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_low_189
NF1343_low_189
[»] chr1 (1 HSPs)
chr1 (72-228)||(1590774-1590930)
[»] chr3 (1 HSPs)
chr3 (6-38)||(31581832-31581864)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 72 - 228
Target Start/End: Complemental strand, 1590930 - 1590774
Alignment:
72 tatgtctggggcttgggtgttcaagaatggcgtgtttcgattggtcgagaatcctcaagcagaatcggaagtaaggcatgggaagaggaagatgttggtt 171  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1590930 tatgtctggggtttgggtgttcaagaatggcgtgtttcgattggtcgagaatcctcaagcagaatcggaagtaaggcatgggaagaggaagatgttggtt 1590831  T
172 cacttgcccacaggggaagtggtaacttcttatgcttttcttgagagaatattgatt 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1590830 cacttgcccacaggggaagtggtaacttcttatgcttttcttgagagaatattgatt 1590774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 31581832 - 31581864
Alignment:
6 aaaatatccattggatttgaatgcaacagctag 38  Q
    |||||||||||||||||||||||||||||||||    
31581832 aaaatatccattggatttgaatgcaacagctag 31581864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University