View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_190 (Length: 226)
Name: NF1343_low_190
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_190 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 91 - 225
Target Start/End: Complemental strand, 27814487 - 27814350
Alignment:
| Q |
91 |
catcatataaaacaagtagttttggtttagaaggtctggaataagtttagatcgatgattagtttttcaaaatcacaatgcattattgtaattttgac-- |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27814487 |
catcatataaaacaagtagttttggtttagaaggtctggaataaatttagatcgatgattagtttttcaaaatcacaatgtattattgtaattttgacaa |
27814388 |
T |
 |
| Q |
189 |
aaactatattttata-tttgaagtatcaaagagagaga |
225 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27814387 |
aaactatattttatactttgaagtatcaaagagagaga |
27814350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 113 - 191
Target Start/End: Complemental strand, 27806715 - 27806637
Alignment:
| Q |
113 |
tggtttagaaggtctggaataagtttagatcgatgattagtttttcaaaatcacaatgcattattgtaattttgacaaa |
191 |
Q |
| |
|
||||||||||||||| |||||||||||||| || | ||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
27806715 |
tggtttagaaggtctagaataagtttagattgagtgtgagtttgtcaaaatcacaatgtattattgtaattttgacaaa |
27806637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University