View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_197 (Length: 212)
Name: NF1343_low_197
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_197 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 48414368 - 48414489
Alignment:
| Q |
1 |
catacatttactcaatttggatattcaaaaacaagttcagttcagactcttcagagggataatgatcttacaacttatctgttgcttcccttatctactc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48414368 |
catacatttattcaatttggatattcaaaaacaagttcagttcagactcttcagagggataatgatcttacaacttatctgttgcttcccttatctactc |
48414467 |
T |
 |
| Q |
101 |
cagtcaatattggtttcctttg |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48414468 |
cagtcaatattggtttcctttg |
48414489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University