View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_low_198 (Length: 209)

Name: NF1343_low_198
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_low_198
NF1343_low_198
[»] chr2 (1 HSPs)
chr2 (73-192)||(4924702-4924821)


Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 73 - 192
Target Start/End: Original strand, 4924702 - 4924821
Alignment:
73 cagagagagagattaattgcaaaaatgattattataataacaagatgaaaggaatgtaggattaattaccttgaatcatcatgatgagatgagtttgtat 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4924702 cagagagagagattaattgcaaaaatgattattataataacaagatgaaaggaatgtaggattaattaccttgaatcatcatgatgagatgagtttgtat 4924801  T
173 gtgaataattacgtgataag 192  Q
    ||||||||||||||||||||    
4924802 gtgaataattacgtgataag 4924821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University