View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_198 (Length: 209)
Name: NF1343_low_198
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_198 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 73 - 192
Target Start/End: Original strand, 4924702 - 4924821
Alignment:
| Q |
73 |
cagagagagagattaattgcaaaaatgattattataataacaagatgaaaggaatgtaggattaattaccttgaatcatcatgatgagatgagtttgtat |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4924702 |
cagagagagagattaattgcaaaaatgattattataataacaagatgaaaggaatgtaggattaattaccttgaatcatcatgatgagatgagtttgtat |
4924801 |
T |
 |
| Q |
173 |
gtgaataattacgtgataag |
192 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4924802 |
gtgaataattacgtgataag |
4924821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University