View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_low_199 (Length: 208)

Name: NF1343_low_199
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_low_199
NF1343_low_199
[»] chr5 (1 HSPs)
chr5 (1-132)||(11884848-11884979)


Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 11884979 - 11884848
Alignment:
1 agttttactttaatcaagagttttgcatgatctgtttggaaataggaagcattatgctcaatattttaaaactcgatcttgtgtatccaaaaactcatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11884979 agttttactttaatcaagagttttgcatgatctgtttggaaataggaagcattatgctcaatattttaaaactcgatcttgtgtatccaaaaactcatca 11884880  T
101 aactacactcttttgcgatacttttcatctca 132  Q
    |||||||||||||||||||||||||| |||||    
11884879 aactacactcttttgcgatacttttcttctca 11884848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University