View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_low_200 (Length: 202)

Name: NF1343_low_200
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_low_200
NF1343_low_200
[»] chr3 (1 HSPs)
chr3 (1-126)||(48414368-48414493)


Alignment Details
Target: chr3 (Bit Score: 122; Significance: 8e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 48414368 - 48414493
Alignment:
1 catacatttactcaatttggatattcaaaaacaagttcagttcagactcttcagagggataatgatcttacaacttatctgttgcttcccttatctactc 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48414368 catacatttattcaatttggatattcaaaaacaagttcagttcagactcttcagagggataatgatcttacaacttatctgttgcttcccttatctactc 48414467  T
101 cagtcaatattggtttcctttgtttc 126  Q
    ||||||||||||||||||||||||||    
48414468 cagtcaatattggtttcctttgtttc 48414493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University