View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_46 (Length: 543)
Name: NF1343_low_46
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_46 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 497 - 543
Target Start/End: Complemental strand, 26127716 - 26127670
Alignment:
| Q |
497 |
aataactttattaagaattttccaagatagtcatcatcttttcgaaa |
543 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26127716 |
aataactttattaagaattttccaagatagtcatcatcttttcgaaa |
26127670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 498 - 537
Target Start/End: Complemental strand, 26125955 - 26125916
Alignment:
| Q |
498 |
ataactttattaagaattttccaagatagtcatcatcttt |
537 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
26125955 |
ataacttcattaagaattttccaagatagttatcatcttt |
26125916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 31581832 - 31581864
Alignment:
| Q |
6 |
aaaatatccattggatttgaatgcaacagctag |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31581832 |
aaaatatccattggatttgaatgcaacagctag |
31581864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University