View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_74 (Length: 433)
Name: NF1343_low_74
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 95 - 424
Target Start/End: Original strand, 41849914 - 41850243
Alignment:
| Q |
95 |
acaaatttgaatgtcttggttattttacatgaagtaagcaatggtataaaatgaagagaaagaaatgaaagagagcgagaccagagcaagtgattgtgaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| || |
|
|
| T |
41849914 |
acaaatttgaatgtcttggttattttacatgaagtaagcaatggtataaaatgaagagaaagaaatgaaatagagtaagaccagagcaagtgattgtaaa |
41850013 |
T |
 |
| Q |
195 |
gggtaaagcagaagtggtgaaacatggtcgtttggttgagtagttgcgtatggccaaactggttcgtgggagttgaattgaaaggttggccattcttctc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41850014 |
gggtaaagcagaagtggtgaaacatggtcgtttggttgagaagttgcgtatggacaaacttgttcgtgggagttgaattgaaaggttggccattcttctt |
41850113 |
T |
 |
| Q |
295 |
tctgcacttcaatttttggaacattcagaattcagacagaccactccacacacccctgcttgcttatctgcggataaatatgttacctggcatcacccgc |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41850114 |
tctgcacttcaatttttggaacattcagaattcagacagaccactccacacacccttgcttgcttatctgcggataaatatgttacctggcatcacacgt |
41850213 |
T |
 |
| Q |
395 |
ggcaacta-gatataatatcttttttatcaa |
424 |
Q |
| |
|
||| |||| |||||||||||| ||||||||| |
|
|
| T |
41850214 |
ggc-actatgatataatatctattttatcaa |
41850243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University