View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_86 (Length: 403)
Name: NF1343_low_86
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_86 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 345; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 35 - 403
Target Start/End: Complemental strand, 34541582 - 34541214
Alignment:
| Q |
35 |
ctagggtttatacaaattaattttctttgcggttttagttttgtgtgaggctaattcgagactttaattcaactaattttaattattctatcgggttctg |
134 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34541582 |
ctagggtttatacaaattatttttctttgtggttttagttttgtgtgagggtaattcgggactttaattcaactaattttaattattctatcgggttctg |
34541483 |
T |
|
| Q |
135 |
tgttgcttggtgtatttatgataattcaactgcttttttaggatgcttgaaaagaggagtttgagctataatggtggaccgattcctgttccccttgacg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34541482 |
tgttgcttggtgtatttatgataattcaactgcttttttaggatgcttgaaaagaggagtttgagctataatggtggaccgattcctgttccccttgacg |
34541383 |
T |
|
| Q |
235 |
aaccctttcttgcagataatgtgcaaagaatttgcgtttgtgatacaggtctctatcttttgtttgtttattttcaattgtctctatggtggttaactgt |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34541382 |
aaccctttcttgcagataatgtgcaaagaatttgcgtttgtgatacaggtctctatcttttgtttatttattttcaattgtctctatggtggttaactgt |
34541283 |
T |
|
| Q |
335 |
tgattttattgctatcattatggagtggcaagatatggagctcaatgatttgatttttaaagtatcatt |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34541282 |
tgattttattgctatcattatggagtggcaagatatggaactcaatgatttgatttttaaagtatcatt |
34541214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 31581832 - 31581864
Alignment:
| Q |
6 |
aaaatatccattggatttgaatgcaacagctag |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31581832 |
aaaatatccattggatttgaatgcaacagctag |
31581864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University