View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_88 (Length: 402)
Name: NF1343_low_88
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_88 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 2133439 - 2133665
Alignment:
| Q |
13 |
tgaagaacggtgtggctaccgatgtaaccggcaccgccggtaactagaacggttttgttttgcgtcatgagagaagcagaattagaattactaccgtttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2133439 |
tgaagaacggtgtggctaccgatgtaaccggcaccgccggtaactagaacggttttgttttgcgtcatgagagaagcagaattagaattactaccgtttt |
2133538 |
T |
|
| Q |
113 |
gggtttggaatgaagaattcttagaaggtgatagaaaacgtgaagagtttaaaggagaagaggtgccattagtgatgccgacgcgagaagccattgaagc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2133539 |
gggtttggaatgaagaattcttagaaggtgatagaaaacgtgaagagtttaaaggagaagaggtgccattagtgatgccgacgcgagaagccattgaagc |
2133638 |
T |
|
| Q |
213 |
gagaattgtgtgatacgttccgaaagt |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2133639 |
gagaattgtgtgatacgttccgaaagt |
2133665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 71
Target Start/End: Original strand, 2129180 - 2129238
Alignment:
| Q |
13 |
tgaagaacggtgtggctaccgatgtaaccggcaccgccggtaactagaacggttttgtt |
71 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
2129180 |
tgaagaacggtgtggctaccaatgtaaccggcaccaccggtaacgagtacggttttgtt |
2129238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 42028349 - 42028299
Alignment:
| Q |
22 |
gtgtggctaccgatgtaaccggcaccgccggtaactagaacggttttgttt |
72 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
42028349 |
gtgtggctgccgatgtaaccggctccgccggtaaccagaatggttttgttt |
42028299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University