View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_97 (Length: 385)
Name: NF1343_low_97
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_97 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 149 - 357
Target Start/End: Original strand, 31581832 - 31582040
Alignment:
| Q |
149 |
aaaatatccattggatttgaatgcaacagctagtgacgtaactttgataacaataattaatgtctagacacataaagaaagatcacnnnnnnntacaaaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31581832 |
aaaatatccattggatttgaatgcaacagctagtgacgtaactttgataacaataattaatgtctagacacataaagaaagatcacaaaaaaatacaaaa |
31581931 |
T |
 |
| Q |
249 |
tgtacattaacctcctaagaattgaacctttgtgggttgcgtggttgtcgtattattaagggatagatatgacccttaacacggatactacgcggagaag |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31581932 |
tgtacattaacctcctaagaattgaacctttgtgggttgcgtggttgtcgtattattaagggatagatatgacccttaacacggatactacgcggagaag |
31582031 |
T |
 |
| Q |
349 |
ttagagaat |
357 |
Q |
| |
|
||||||||| |
|
|
| T |
31582032 |
ttagagaat |
31582040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University