View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13440_high_2 (Length: 349)
Name: NF13440_high_2
Description: NF13440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13440_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 17 - 338
Target Start/End: Complemental strand, 45422428 - 45422107
Alignment:
| Q |
17 |
aattctctacttctttcatatccagagtttgatttggtagcagcatttaaagttaagtgtttttgttgttgaaattttgtacaagcaactgcttttgatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45422428 |
aattctctacttctttcatatccagagtttgatttggtagcagcatttaaagttaagtgtttttgttgttgaaattttgtacaagcaactgcttttgatt |
45422329 |
T |
|
| Q |
117 |
ctttctcttgtactctttgttgatttgatttgagaaacactgcaggtatagaaaagtttgagaagttcacttttccannnnnnngatattcacaccccat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45422328 |
ctttctcttgtactctttgttgatttgatttgagaaacactgcaggtatagaaaagtttgagaagttcacttttccatttttttgatattcacaccccat |
45422229 |
T |
|
| Q |
217 |
caagtactgtttctgtgagtttgttgttgcagtttggtttgaatccactcttggttttttgaaaggagttaaatatgtgaacatgtgagaggaacctagg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45422228 |
caagtactgtttctgtgagtttgttgttgcagtttggtttgaatccactcttggttttttgagaggagttaaatatgtgaacatgtgagaggaacctagg |
45422129 |
T |
|
| Q |
317 |
ccattgctttttgtcatctctg |
338 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45422128 |
ccattgctttttgtcatctctg |
45422107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University