View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13441_high_29 (Length: 206)
Name: NF13441_high_29
Description: NF13441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13441_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 102 - 193
Target Start/End: Complemental strand, 41890207 - 41890116
Alignment:
| Q |
102 |
tattttatagggggtaaacctggaaattacttatattacatgagggtaaagtaggtgacggcgttcacataaaatctaaaattgtcacatat |
193 |
Q |
| |
|
||||||| ||||||||||||||||||| || ||||||||||| | |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41890207 |
tattttacagggggtaaacctggaaatgacatatattacatgggagtaaagtaggtgacggtgttcacataaaatctaaaattgtcacatat |
41890116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University