View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13441_low_16 (Length: 344)
Name: NF13441_low_16
Description: NF13441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13441_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 89 - 335
Target Start/End: Original strand, 8773871 - 8774117
Alignment:
| Q |
89 |
attgatcatcatgaaacaacaatcttgtcttctattgtatttgtaacatcctttattgattttctctgtannnnnnngttatttcgatcaaactatgttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8773871 |
attgatcatcatgaaacaacaatcttgtcttctattgtatttgtaacaccctttattgattttctctgtatttttttgttatttcgatcaaactatgttt |
8773970 |
T |
|
| Q |
189 |
gcannnnnnncattgaaaataattaacaaaataggttgtctttgtcaatcacnnnnnnngttacctaagggccatgcatgcaaaccctgatttgagcctt |
288 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8773971 |
gcatttttttcattgaaattaattaacaaaataggttgtctttgtcaatcactttttttgttacctaagggccatgcatgcaaaccctgatttgagcctt |
8774070 |
T |
|
| Q |
289 |
ttgacttatttgagcttataaacgggaataagtacttctgatgatgt |
335 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8774071 |
ttgacttatttgagcttataaactggaataagtacttctgatgatgt |
8774117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University