View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13441_low_17 (Length: 343)
Name: NF13441_low_17
Description: NF13441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13441_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 13 - 324
Target Start/End: Original strand, 50392418 - 50392725
Alignment:
| Q |
13 |
aatatggtggtaagcccctttaattctacagtatggaagtcaaactttttcattctcagtatgcttttatcatgtcgttgagttcatatgattgctcatt |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50392418 |
aatatggtggtaagctcctttaattctacagtatggaagtcaaactttttaattctcagtatgcttttatcatgtcgttgagttcatatgattgctcatt |
50392517 |
T |
 |
| Q |
113 |
atggacacactgctcttttcatattactacttttagttttattcatgcnnnnnnngcaaccttttgtaaatgtgatgttggaggtattcctgatcatcag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50392518 |
atggacacactgctcttttcatattactacttttaattttattcctgcttttat-gcaaccttttgtaaatgtgatgttggaggtattcct---catcag |
50392613 |
T |
 |
| Q |
213 |
cagcagttgagttaataaattactaattaaattttttgtttatcaaattttgttggtttcaaacacaacttgtatccatgacaatcttgttgactaaaag |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50392614 |
cagcagttgagttaataaattactaattaaattttttatttatcaaattttgttggtttcaaacacaacttgtatccatgacaatcttgttgactaaaag |
50392713 |
T |
 |
| Q |
313 |
atatatgtataa |
324 |
Q |
| |
|
|||||||||||| |
|
|
| T |
50392714 |
atatatgtataa |
50392725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University