View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13441_low_22 (Length: 279)
Name: NF13441_low_22
Description: NF13441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13441_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 159 - 261
Target Start/End: Complemental strand, 34974907 - 34974805
Alignment:
| Q |
159 |
gaaccaaaccagtgctgatttgatgtgcagtgtctggaatttgaacatcgttgttatcaacatcaggtagcagttcaatctgctcctcctcatcaacaga |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34974907 |
gaaccaaaccagtgctgatttgatgtgcagtgtctggaatttgaacatcgttgttatcaacatcaggtagcagttcaatctgctcctcctcatcaacaga |
34974808 |
T |
 |
| Q |
259 |
aac |
261 |
Q |
| |
|
||| |
|
|
| T |
34974807 |
aac |
34974805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 34975050 - 34974987
Alignment:
| Q |
4 |
tccaagaatataagcactattaattcctgttgtcaacacaaaccccacttgaaaccatgaatct |
67 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34975050 |
tccaagaacataagcactattaattcctgttgtcaacacaaaccccacttgaaaccatgaatct |
34974987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University