View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13441_low_27 (Length: 227)
Name: NF13441_low_27
Description: NF13441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13441_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 14228222 - 14228445
Alignment:
| Q |
1 |
tcttctcaccattcaatccatcgtttttgttgattcttcctggtctatccttcgccggcgatgcaccgacgccggaggaagaagcggtggactgagaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14228222 |
tcttctcaccattcaatccatcgtttttgttgattcttcctggtctatccttcgccggcgatgcaccgacgccggatgaagaagcggtggactgagaatc |
14228321 |
T |
 |
| Q |
101 |
aaggtgttcgcatttggcgaagagggaatcgagtggtaaatcgtggttgaggcgttgagcgattttgatgaatttgagagcgcgagatttgttacctgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14228322 |
aaggtgttcgcatttggcgaagagggaatcgagtggtaaatcgtggttgaggcgttgagcgattttgatgaatttgagagcgcgagatttgttacctgat |
14228421 |
T |
 |
| Q |
201 |
gagattgcttcttctgcgatttga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14228422 |
gagattgcttcttctgcgatttga |
14228445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 106 - 223
Target Start/End: Original strand, 14231958 - 14232075
Alignment:
| Q |
106 |
gttcgcatttggcgaagagggaatcgagtggtaaatcgtggttgaggcgttgagcgattttgatgaatttgagagcgcgagatttgttacctgatgagat |
205 |
Q |
| |
|
||||||||||||| || | |||||| || |||| |||| |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14231958 |
gttcgcatttggctaacaaggaatcaagaggtagatcgcggttgaggcgctgagcgatcttgatgaatttgagagcgcgagatttgttacctgatgagat |
14232057 |
T |
 |
| Q |
206 |
tgcttcttctgcgatttg |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14232058 |
tgcttcttctgcgatttg |
14232075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University