View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13441_low_29 (Length: 206)

Name: NF13441_low_29
Description: NF13441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13441_low_29
NF13441_low_29
[»] chr5 (1 HSPs)
chr5 (102-193)||(41890116-41890207)


Alignment Details
Target: chr5 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 102 - 193
Target Start/End: Complemental strand, 41890207 - 41890116
Alignment:
102 tattttatagggggtaaacctggaaattacttatattacatgagggtaaagtaggtgacggcgttcacataaaatctaaaattgtcacatat 193  Q
    ||||||| ||||||||||||||||||| || ||||||||||| | |||||||||||||||| ||||||||||||||||||||||||||||||    
41890207 tattttacagggggtaaacctggaaatgacatatattacatgggagtaaagtaggtgacggtgttcacataaaatctaaaattgtcacatat 41890116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University