View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13443_high_17 (Length: 340)
Name: NF13443_high_17
Description: NF13443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13443_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 41705408 - 41705742
Alignment:
| Q |
1 |
ccacaaccaactctctctcccactctcaccaggctccgattacactctctccttcaacctcggaccccactcccaacccataactctctacatggacaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705408 |
ccacaaccaactctctctcccactctcaccaggctccgattacactctctccttcaacctcggaccccactcccaacccataactctctacatggacaca |
41705507 |
T |
 |
| Q |
101 |
ggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctaccaacatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705508 |
ggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctaccaacatct |
41705607 |
T |
 |
| Q |
201 |
cccacagcacccccatgtcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgccctttaga |
300 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705608 |
cccacagcacccccatttcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgccctttaga |
41705707 |
T |
 |
| Q |
301 |
ctccattgaaaccaaagactgcggttcatctcact |
335 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41705708 |
ctccattgaaaccaaagactgcggttcatttcact |
41705742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 74 - 154
Target Start/End: Complemental strand, 3744418 - 3744338
Alignment:
| Q |
74 |
caacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaa |
154 |
Q |
| |
|
|||| |||||| ||||||||||||||||| || ||||||||||||||||| || |||| ||| | ||||| ||||||||| |
|
|
| T |
3744418 |
caactcataacactctacatggacacaggtagcgaccttgtttggttcccttgttcacctttcgaatgcattctctgtgaa |
3744338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University