View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13443_high_18 (Length: 338)
Name: NF13443_high_18
Description: NF13443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13443_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 50530481 - 50530151
Alignment:
| Q |
1 |
cacacagaaaaacaaaaccaaagagcgcacgcaatgacaagccatggctcatcgttttcgagcctcccaaactatctccaagccgtcgctaaaactccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530481 |
cacacagaaaaacaaaaccaaagagcgcacgcaatgacaagccatggctcatcgttttcgagcctcccaaactatctccaagccgtcgctaaaactccct |
50530382 |
T |
 |
| Q |
101 |
ctcgctttgctcgtcgcggcttctccgtctccacttcttacgaagaaatgagccgcgttcgagctaggtccggtaacagcatgcgcaaaaccctccgttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
50530381 |
ctcgctttgctcgtcgcggcttctccgtctccacttcttacgaagaaatgagccgtgttcgagctaggtccggcaacagcatgcgcaaaagcctccgttg |
50530282 |
T |
 |
| Q |
201 |
gtttgacttagtcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggcccttccgttgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530281 |
gtttgacttagtcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggcccttccgttgtt |
50530182 |
T |
 |
| Q |
301 |
ctatcttacgccattgccggtttctgtgctc |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50530181 |
ctatcttacgccattgccggtttctgtgctc |
50530151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University