View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13443_high_26 (Length: 313)
Name: NF13443_high_26
Description: NF13443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13443_high_26 |
 |  |
|
| [»] scaffold0728 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0728 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: scaffold0728
Description:
Target: scaffold0728; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 30 - 287
Target Start/End: Complemental strand, 5646 - 5389
Alignment:
| Q |
30 |
catgggtccgtaggtgatccaacaactggggaagggattttggaaccaagttccctagaactaacactctgcagctgttgctgctgtttctcgcgatgag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5646 |
catgggtccgtaggtgatccaacaactgaggaagggattttgtaaccaagttccctagagctaacactctgcagttgttgctgctgtttctcgcgatgag |
5547 |
T |
 |
| Q |
130 |
gaaatgtggacatttgagggatcagtggggagattggttcaagccttctaggtgacatactaccgcatgaagggacaccaaatgaagcttgtaaaagacg |
229 |
Q |
| |
|
||| || |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5546 |
gaagtgcagacatttgagggctcagtggggagatttgttcaagccttctaggtgacatgctaccgcatgaagggacactaaatgaagcttgtaaaagacg |
5447 |
T |
 |
| Q |
230 |
atgctcttcattcttgggagacagcatattagtatttgaaggcgataacatatgttga |
287 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5446 |
atgctcatcattcttgggagacagcatattaatatttgaaggcgataacatatgttga |
5389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 30 - 287
Target Start/End: Complemental strand, 19410080 - 19409823
Alignment:
| Q |
30 |
catgggtccgtaggtgatccaacaactggggaagggattttggaaccaagttccctagaactaacactctgcagctgttgctgctgtttctcgcgatgag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19410080 |
catgggtccgtaggtgatccaacaactgaggaagggattttgtaaccaagttccctagagctaacactctgcagttgttgctgctgtttctcgcgatgag |
19409981 |
T |
 |
| Q |
130 |
gaaatgtggacatttgagggatcagtggggagattggttcaagccttctaggtgacatactaccgcatgaagggacaccaaatgaagcttgtaaaagacg |
229 |
Q |
| |
|
||| || |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19409980 |
gaagtgcagacatttgagggctcagtggggagatttgttcaagccttctaggtgacatgctaccgcatgaagggacactaaatgaagcttgtaaaagacg |
19409881 |
T |
 |
| Q |
230 |
atgctcttcattcttgggagacagcatattagtatttgaaggcgataacatatgttga |
287 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19409880 |
atgctcatcattcttgggagacagcatattaatatttgaaggcgataacatatgttga |
19409823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University