View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13446_high_4 (Length: 292)
Name: NF13446_high_4
Description: NF13446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13446_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 161
Target Start/End: Original strand, 7885113 - 7885256
Alignment:
| Q |
18 |
gatatgacaccttggaagaactattagaagtgatcacctcacctgggctcaactaggaattcatgataaacctgtaagcatatactctcaatagaagtgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7885113 |
gatatgacaccttggaagaactattagaagtgatcacctcacctgggctcaactaggaattcatgataaacctgtaagcatatactctcaatagaagtgt |
7885212 |
T |
 |
| Q |
118 |
aatggaatgtttaaaaagtatcttaaactaacatttgacatgtt |
161 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7885213 |
aatggaatgtttaaaaagtatcttaaagtaacatttgacatgtt |
7885256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 156 - 273
Target Start/End: Original strand, 7885284 - 7885408
Alignment:
| Q |
156 |
catgttctctacactttttgtgtgtgagtttcgccactagattctttaacattaaaaaatcttaataaatgcaaaaatggattaattgc-------attg |
248 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
7885284 |
catgttctctacactttgtgtgtgtgagtttcgccactagattctttaacattaaaaaatcttaataaatgaaaaaatggattgattgcattatatattg |
7885383 |
T |
 |
| Q |
249 |
caggtgggattgttgaatgtggatg |
273 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7885384 |
caggtgggattgttgaatgtggatg |
7885408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University