View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13446_low_3 (Length: 300)
Name: NF13446_low_3
Description: NF13446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13446_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 53 - 236
Target Start/End: Complemental strand, 36036370 - 36036185
Alignment:
| Q |
53 |
cttggtttatgtggttgctattagactgaatatatcaaattgaatatatgaaaaaatcatacagaacatgcagaagaacaaataaag--gggcaataaat |
150 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
36036370 |
cttggtttatgtggttgctattagactaaacatatcaaattgaatatatgaaaaaatcatacagaacatgcagaagaacaaaaaaaaatgagcaataaat |
36036271 |
T |
|
| Q |
151 |
tcttaccagtagaaactgaagagcatatagaagcctgcatatcaacaccatcttggttggcatcattttcaggtccataagaatct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36036270 |
tcttaccagtagaaactgaagagcatatagaagcatgcatatcaacaccatcttggttggcatcattttcaggtccataagaatct |
36036185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University