View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13446_low_5 (Length: 279)
Name: NF13446_low_5
Description: NF13446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13446_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 6 - 264
Target Start/End: Original strand, 313068 - 313326
Alignment:
| Q |
6 |
ggacatcatcaaaaatgatttttcatataaactaaaattaaaaagtgacatatttataagatttaaatggtatatctaaaccaaatataaattagtaaat |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
313068 |
ggacctcattaaaaatgatttttcatataaactaaaattaaaaagtgacatatttataagatttaaatggtatatctaaaccaaatattaattaataaat |
313167 |
T |
|
| Q |
106 |
aaattacttgcctggatctcaatgagcacattagaaaatgcataggcaaatgcaatgtcaccaattgcttggaacatcctccacaccttttctgttgcag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
313168 |
aaattacttgcctggatctcaatgagcacattagaaaatgcataggcaaatgcaatgtcaccaatagcttggaacatcctccacaccttttctgttgcag |
313267 |
T |
|
| Q |
206 |
taacatccaccccaatttgcacaccagttaaggatgttgtcacatgatttcccccacct |
264 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
313268 |
taacatctaccccaatttgcacaccagttaaggatgttgtcacatgatttcccccacct |
313326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 111 - 242
Target Start/End: Original strand, 51718952 - 51719083
Alignment:
| Q |
111 |
acttgcctggatctcaatgagcacattagaaaatgcataggcaaatgcaatgtcaccaattgcttggaacatcctccacaccttttctgttgcagtaaca |
210 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| | ||||| || || |||||||||||||| ||||| |||||||||||||||||||| || | ||||| |
|
|
| T |
51718952 |
acttgcctgtatctcaatgaggacattagaataagcataagcgaaggcaatgtcaccaatagcttgaaacatcctccacaccttttcagtccctgtaacg |
51719051 |
T |
|
| Q |
211 |
tccaccccaatttgcacaccagttaaggatgt |
242 |
Q |
| |
|
|||||||||| |||||| || ||||| ||||| |
|
|
| T |
51719052 |
tccaccccaacttgcacccctgttaatgatgt |
51719083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University