View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1344_low_11 (Length: 306)

Name: NF1344_low_11
Description: NF1344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1344_low_11
NF1344_low_11
[»] chr1 (2 HSPs)
chr1 (85-245)||(6451364-6451524)
chr1 (13-48)||(6451316-6451351)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 85 - 245
Target Start/End: Original strand, 6451364 - 6451524
Alignment:
85 attaaataacatctctgcgtctgcatcatgtggctctgtgacatggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt 184  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6451364 attaaataacatctctgcgtctgcatcatgtggctctgtgacctggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt 6451463  T
185 aattttcttcccagtttctgatcagttacccatttttgctctcttcaatttgggggtatct 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6451464 aattttcttcccagtttctgatcagttacccatttttgctctcttcaatttgggggtatct 6451524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 13 - 48
Target Start/End: Original strand, 6451316 - 6451351
Alignment:
13 aatatatagttatgtatgacattggttaatggttga 48  Q
    ||||||||||||||||||||||||||||||||||||    
6451316 aatatatagttatgtatgacattggttaatggttga 6451351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University