View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1344_low_11 (Length: 306)
Name: NF1344_low_11
Description: NF1344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1344_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 85 - 245
Target Start/End: Original strand, 6451364 - 6451524
Alignment:
| Q |
85 |
attaaataacatctctgcgtctgcatcatgtggctctgtgacatggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6451364 |
attaaataacatctctgcgtctgcatcatgtggctctgtgacctggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt |
6451463 |
T |
|
| Q |
185 |
aattttcttcccagtttctgatcagttacccatttttgctctcttcaatttgggggtatct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6451464 |
aattttcttcccagtttctgatcagttacccatttttgctctcttcaatttgggggtatct |
6451524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 13 - 48
Target Start/End: Original strand, 6451316 - 6451351
Alignment:
| Q |
13 |
aatatatagttatgtatgacattggttaatggttga |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6451316 |
aatatatagttatgtatgacattggttaatggttga |
6451351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University