View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1344_low_13 (Length: 266)

Name: NF1344_low_13
Description: NF1344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1344_low_13
NF1344_low_13
[»] chr4 (2 HSPs)
chr4 (174-241)||(26245803-26245870)
chr4 (44-109)||(26245680-26245745)


Alignment Details
Target: chr4 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 174 - 241
Target Start/End: Original strand, 26245803 - 26245870
Alignment:
174 gttaaaatctttataattgaattgcagaaacccttgcacgatagcttcttccttccaaagcccctatg 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
26245803 gttaaaatctttataattgaattgcagaaacccttgcacgatagcttcttccttccatagcccctatg 26245870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 44 - 109
Target Start/End: Original strand, 26245680 - 26245745
Alignment:
44 ctatcagttcctgcaactcccaccttcaccatcgcttctcacagaagaatcccttctaaactcgcg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
26245680 ctatcagttcctgcaactcccaccttcaccatcgcttctcacagaagaatcccttctcaactcgcg 26245745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University