View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1344_low_8 (Length: 379)
Name: NF1344_low_8
Description: NF1344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1344_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 5e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 134 - 282
Target Start/End: Original strand, 9016241 - 9016389
Alignment:
| Q |
134 |
gttaaacaagacacgttagggttatgattaaaatgtaatcctatgacaaattacatactttggctttaatttaacttgacctaacctattcctacactta |
233 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9016241 |
gttaaacaagacacgttagggttatgactaaaatgtaatcctatgacaaattacatactttggctttaatttaacttgacctaacctattcctatactta |
9016340 |
T |
|
| Q |
234 |
ttgttcaacaacttaccaataaaattgaagatcaatttcatgttccttt |
282 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
9016341 |
ttgttcaacaacttagcaataaaattgaagatcaatttcatgtttcttt |
9016389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University