View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1344_low_9 (Length: 337)
Name: NF1344_low_9
Description: NF1344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1344_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 181 - 329
Target Start/End: Original strand, 38150938 - 38151086
Alignment:
| Q |
181 |
aatatacctgattaacctatataaaaataaaataaaactttctctcacctctctactgtcatacagtactggattcatgcaaatagcaacttctctacgc |
280 |
Q |
| |
|
|||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38150938 |
aatatagctgattaaccaaaataaaaataaaataaaactttctctcacctctctactgtcatacagtactggattcatgcaaatagcaacttctctacgc |
38151037 |
T |
|
| Q |
281 |
ctttaaccactcttcacttcacagtcacttcatttgttcccttcatctc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38151038 |
ctttaaccactcttcacttcacagtcacttcatttgttcccttcgtctc |
38151086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 121 - 182
Target Start/End: Original strand, 38150831 - 38150892
Alignment:
| Q |
121 |
gtgcacaattttaatactatttcagtgagaactctatcaaatctaattattcttataaacaa |
182 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38150831 |
gtgcaaaattttaatactattacagtgagaactctatcaaatctaattattcttataaacaa |
38150892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University