View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13451_high_1 (Length: 402)
Name: NF13451_high_1
Description: NF13451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13451_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 18 - 338
Target Start/End: Original strand, 2793821 - 2794141
Alignment:
| Q |
18 |
actcaatgccattgatgacggtgtttacgagccaaagacgaaggaaactcgtgctgcttatgaggcgatgttgagtgtaatccagcagcggtttggtggt |
117 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2793821 |
actcaatgccgttgataacggtgtttacgagccaaagacgaaggaaactcgtgctgcttatgaggcgatgttgagtgtaatccagcagcggtttggtggt |
2793920 |
T |
|
| Q |
118 |
cagccgcttgggattatcagaggtgctgctgatgagattctttccattctgaaaaacgactctattggtgacaagaagattaacattgagaaactgctta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2793921 |
cagccgcttgggattatcagaggtgctgctgatgagattctttccattctgaaaaacgactctgttggtgacaagaagattaacattgagaaactgctta |
2794020 |
T |
|
| Q |
218 |
accctatcactgatactgtgtttaatcaccttgtttcgattggaaaggttataactgattttctggagtttgaggatgttgagggtggttttgattcttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2794021 |
accctatcactgatactgtgtttaatcaccttgtttcgattggaaagcttataactgattttctggagtttgaggatgtggagggtggttttgattcttt |
2794120 |
T |
|
| Q |
318 |
tgacggtgttgcagtggaatt |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2794121 |
tgacggtgttgcagtggaatt |
2794141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 123
Target Start/End: Original strand, 29261256 - 29261349
Alignment:
| Q |
30 |
tgatgacggtgtttacgagccaaagacgaaggaaactcgtgctgcttatgaggcgatgttgagtgtaatccagcagcggtttggtggtcagccg |
123 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| || | || |||||||| || ||||||||||| || ||||| | | |||||||||||||| |
|
|
| T |
29261256 |
tgatgacggtgtttatcagccgaagacgaaggagacaagagcagcttatgaagctatgttgagtgtgattcagcaacagcttggtggtcagccg |
29261349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University