View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13451_high_11 (Length: 321)
Name: NF13451_high_11
Description: NF13451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13451_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 2 - 293
Target Start/End: Complemental strand, 39775720 - 39775429
Alignment:
| Q |
2 |
gacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccgaataatgcagcacaattgcacaaacat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39775720 |
gacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgcacaaacat |
39775621 |
T |
|
| Q |
102 |
ttcatgtccatcgatccatcaaataaggactaccccacaaaataaaaccattgctattatttttgttttcaatgatcaatccaacaagagacaactcaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39775620 |
ttcatgtccatcgatccatcaaataaggactaccccacaaaataaaaccattgctattatttttgttttcaatgatcaatccaacaagggacaactcaaa |
39775521 |
T |
|
| Q |
202 |
atagattgaaaggcattataacgacaagagcatgataccttaaagtagagtacggtcatgcttaattaaacatcgcttgtaagatcaaaatt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775520 |
atagattgaaaggcattataacgacaagagcatgataccttaaagtagagtacggtcatgcttaattaaacatcgcttgtaagatcaaaatt |
39775429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University