View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13451_high_14 (Length: 303)
Name: NF13451_high_14
Description: NF13451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13451_high_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 38 - 303
Target Start/End: Original strand, 51770691 - 51770948
Alignment:
| Q |
38 |
caaatttcattataccatcaagaaagaaagaa----gtgttgttggtgaaatgaatgaatgaaagaaaaggtagtaagtaatatttgnnnnnnnnnnnnn |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51770691 |
caaatttcattataccatcaagaaagaaagaaagaagtgttgttggtgaaatgaatgaatgaaagaaaaggtagt----aatatttgtatataatataat |
51770786 |
T |
|
| Q |
134 |
nnnnnnngcctggcttcaacctgtctgccttaatggacgcaaatgcaatggtacgatgtcaatgtctgatgagcaacgaggttgttgttggatttgcaaa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51770787 |
at-----gcctggcttcaacctgtctgccttaatggacgcaaatgcaatggtacgatgtcaatgtctgatgagcaacgaggttgttgttggatttgcaaa |
51770881 |
T |
|
| Q |
234 |
gagaaccaccacctgtttgtgagcaagggtataagggtcattgcatgttgctgctagtactactactact |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51770882 |
gagaaccaccacctgtttgtgagcaagggtataagggtcattgca---tgctgctagtactactactact |
51770948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University