View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13451_high_16 (Length: 301)
Name: NF13451_high_16
Description: NF13451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13451_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 79 - 291
Target Start/End: Original strand, 27208766 - 27208977
Alignment:
| Q |
79 |
atatattttttgttttactcaaaatttcatacaaaagaacaaacctcatattttccgacggaaagatgggcatgtgagtgtcagtcttatcttctctggt |
178 |
Q |
| |
|
|||||| |||||||||| ||||||||||||| |||| |||||| ||||||||||| | ||| ||||||||||||| ||| | |||| ||| | | || |
|
|
| T |
27208766 |
atatatattttgttttaatcaaaatttcataaaaaa-aacaaagctcatattttcgagctgaatgatgggcatgtgaatgtta-tcttctctagt-tagt |
27208862 |
T |
|
| Q |
179 |
ggtataaggta---acaaatattcacttattagtgacataaaaataggtnnnnnnntaacgacgtcccctcttttgctagtattcttgtttcatgtaatc |
275 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27208863 |
ggtataaggtactaacaaatattcactttttagtgacataaaaataggtaaaaaaataacgatgtcccctcttttgctagtattcttgtttaatgtaat- |
27208961 |
T |
|
| Q |
276 |
ctgtttttcttctgtg |
291 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
27208962 |
ttttttttcttctgtg |
27208977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 5 - 47
Target Start/End: Original strand, 27208638 - 27208680
Alignment:
| Q |
5 |
tgaaactgaatttgcattggggtattactcaagattcgtatac |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27208638 |
tgaaactgaatttgcattggggtattactcaagattcctatac |
27208680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University