View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13451_high_8 (Length: 329)
Name: NF13451_high_8
Description: NF13451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13451_high_8 |
 |  |
|
| [»] scaffold1717 (1 HSPs) |
 |  |  |
|
| [»] scaffold1527 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 76 - 308
Target Start/End: Complemental strand, 37757501 - 37757269
Alignment:
| Q |
76 |
gattatgggaagccgtggattcggtgcgacgaagagaagttctaatgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgtt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37757501 |
gattatgggaagccgtggattcggtgcgacgaagagaagttctaatgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgtt |
37757402 |
T |
 |
| Q |
176 |
gtagttgtaaggtatccggaggagagtaatggcggcggcgccggagttgaagggaatgatggtgaaaaagttgaacttcatcctgttattgaggaagaac |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37757401 |
gtagttgtaaggtatccggaggagagtaatggcggtggcgccggagttgaagggaatgatggtgaaaaagttgaacttcatcctgttattgaggaagaac |
37757302 |
T |
 |
| Q |
276 |
atgaagatgagtatcatgatgctgatgatgatg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37757301 |
atgaagatgagtatcatgatgctgatgatgatg |
37757269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1717 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1717
Description:
Target: scaffold1717; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 120 - 183
Target Start/End: Complemental strand, 460 - 397
Alignment:
| Q |
120 |
atgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgtagttgt |
183 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
460 |
atgggaagcttgggagtgttagtgattactgtgtgcatcattgtgtttgtcctgttgttgttgt |
397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1527 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1527
Description:
Target: scaffold1527; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 120 - 183
Target Start/End: Complemental strand, 706 - 643
Alignment:
| Q |
120 |
atgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgtagttgt |
183 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
706 |
atgggaagcttgggagtgttagtgattactgtgtgcatcattgtgtttgtcctgttgttgttgt |
643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University