View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13452_low_1 (Length: 275)
Name: NF13452_low_1
Description: NF13452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13452_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 260
Target Start/End: Complemental strand, 35410092 - 35409851
Alignment:
| Q |
19 |
ccagatgccactcagccacatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggactagtatagagaagttggtca |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35410092 |
ccagatgccactcggccacatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggtctagtatagagaagttggtca |
35409993 |
T |
|
| Q |
119 |
ggacctatgtgaaccattactacaaagatttgaatgccgtttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409992 |
ggacctatgtgaaccattactacaaagatttgaatgccatttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctga |
35409893 |
T |
|
| Q |
219 |
tcataaaaatgctacctggtggcctaaactaaacacccctga |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409892 |
tcataaaaatgctacctggtggcctaaactaaacacccctga |
35409851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University