View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13455_high_5 (Length: 250)
Name: NF13455_high_5
Description: NF13455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13455_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 23 - 248
Target Start/End: Original strand, 44567053 - 44567278
Alignment:
| Q |
23 |
agtcgcggtattggtctagaaggtttttctagtttgttggctggtctctggggtactggaatgggatcaacaactctaaccgaaaatgttcacacaattg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44567053 |
agtcgcggtattggtctagaaggtttttctagtttgttggctggtctctggggtactggaatgggatcaacaactctaaccgaaaatgttcacacaattg |
44567152 |
T |
|
| Q |
123 |
ctgggacaaaaatgggaagccgcagaccagttcaattgggtgcgtgtcttctcatagtattatctctatttggtaagtatctattatcattctgttgttg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44567153 |
ctgggacaaaaatgggaagccgcagaccagttcaattgggtgcgtgtcttctcatagtattatctctatttggtaagtatctattatcattctgttgttg |
44567252 |
T |
|
| Q |
223 |
catttgcatctacctttgctactcca |
248 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
44567253 |
catttgcatctacctttgttactcca |
44567278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 23 - 210
Target Start/End: Complemental strand, 36031690 - 36031503
Alignment:
| Q |
23 |
agtcgcggtattggtctagaaggtttttctagtttgttggctggtctctggggtactggaatgggatcaacaactctaaccgaaaatgttcacacaattg |
122 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||| | ||||||||||||||||||||||||| ||||| || ||| |||| ||||||||||| ||||||| |
|
|
| T |
36031690 |
agtcgcggaattggtctggaaggtctttctagtgttttggctggtctctggggtactggaactggatctaccactttaactgaaaatgttcatacaattg |
36031591 |
T |
|
| Q |
123 |
ctgggacaaaaatgggaagccgcagaccagttcaattgggtgcgtgtcttctcatagtattatctctatttggtaagtatctattatc |
210 |
Q |
| |
|
||| ||| |||||||||||||||||| |||||||||||||||| ||| |||| ||||| |||||||| | ||||||||||||||||| |
|
|
| T |
36031590 |
ctgtgactaaaatgggaagccgcagagcagttcaattgggtgcatgtattctgatagtgttatctctcgtgggtaagtatctattatc |
36031503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 23 - 144
Target Start/End: Original strand, 20124152 - 20124273
Alignment:
| Q |
23 |
agtcgcggtattggtctagaaggtttttctagtttgttggctggtctctggggtactggaatgggatcaacaactctaaccgaaaatgttcacacaattg |
122 |
Q |
| |
|
||||| || |||||| | |||||| ||| |||| | ||||||||||||||||| ||||||| ||||| |||||| |||||||||||||||| ||||||| |
|
|
| T |
20124152 |
agtcgaggaattggtttggaaggtctttgtagtgtcttggctggtctctggggaactggaactggatctacaactttaaccgaaaatgttcatacaattg |
20124251 |
T |
|
| Q |
123 |
ctgggacaaaaatgggaagccg |
144 |
Q |
| |
|
| | ||| |||||||||||||| |
|
|
| T |
20124252 |
ccgtgactaaaatgggaagccg |
20124273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 226
Target Start/End: Complemental strand, 16069436 - 16069361
Alignment:
| Q |
151 |
agttcaattgggtgcgtgtcttctcatagtattatctctatttggtaagtatctattatcattctgttgttgcatt |
226 |
Q |
| |
|
||||||||| ||||| |||||||| | |||||||||||| |||| |||||||||||||||||| ||||||| |||| |
|
|
| T |
16069436 |
agttcaattaggtgcatgtcttctgacagtattatctctctttgctaagtatctattatcattttgttgtttcatt |
16069361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University