View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13456_low_2 (Length: 303)
Name: NF13456_low_2
Description: NF13456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13456_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 18 - 164
Target Start/End: Complemental strand, 6033017 - 6032871
Alignment:
| Q |
18 |
aatgtctccatatgaaaacgattctttgtaaaagcacttttagaataattcattcttatgatctcagaatatgctgaaaaatatcagctaatatcgattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6033017 |
aatgtctccatatgaaaacgattctttgtaaaagcacttttagaataattcattcttatgatctcagaatatgctgaaaaatatcagctaatatcgattt |
6032918 |
T |
 |
| Q |
118 |
ggactggtattgcaatcctcccatgattttccaaagatttgaagccc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032917 |
ggactggtattgcaatcctcccatgattttccaaagatttgaagccc |
6032871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 227 - 291
Target Start/End: Complemental strand, 6032802 - 6032738
Alignment:
| Q |
227 |
taattttatgttttgaaacagtgaaacaattatcaaataaagaaaaacactagttacctgatgat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032802 |
taattttatgttttgaaacagtgaaacaattatcaaataaagaaaaacactagttacctgatgat |
6032738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 128 - 164
Target Start/End: Complemental strand, 6713012 - 6712976
Alignment:
| Q |
128 |
tgcaatcctcccatgattttccaaagatttgaagccc |
164 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
6713012 |
tgcattcctcccatgattttccaaagatttggagccc |
6712976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University