View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13456_low_4 (Length: 251)
Name: NF13456_low_4
Description: NF13456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13456_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 17 - 132
Target Start/End: Complemental strand, 9083226 - 9083111
Alignment:
| Q |
17 |
ataaaaataaatcaaacttaataccaaaaatttaccctttagatacattcaataaatgacgatattagatagaccacatatatcatttattaaagagaaa |
116 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9083226 |
ataaaaataaatcaaacttaatataaaaattttaccctttagatacattcaataaatgacgatattatgtagaccacatatatcatttattaaagagaaa |
9083127 |
T |
|
| Q |
117 |
tgatatatgtacaact |
132 |
Q |
| |
|
|||||| |||| |||| |
|
|
| T |
9083126 |
tgatatttgtataact |
9083111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 9083048 - 9082993
Alignment:
| Q |
196 |
ctctattactttaatttttatgtcaaagcacacttctctgtaaaactgtggttgtc |
251 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
9083048 |
ctctgttactttggtttttatgtcaaagcacacttctgtgtaaaaatgtggttgtc |
9082993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University