View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13457_low_3 (Length: 292)
Name: NF13457_low_3
Description: NF13457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13457_low_3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 9 - 292
Target Start/End: Original strand, 5758005 - 5758289
Alignment:
| Q |
9 |
gaagaatatctaatactatattaatttgcactatatagcttaaatcacaaagagatagctgagcactaaacatggtcttaggatcatgaacctgttcatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5758005 |
gaagaatatctaatactatattaatttgcactatatagcttaaatcacaaagagatagctgagcactaaacatggtcttaggatcatgaacctgttcatg |
5758104 |
T |
 |
| Q |
109 |
tatctcacctttcacaatgttagtttcattttgttttcattttctctgtaatatgcaagagggagtaaatc-nnnnnnngtgaaaatcactttctagatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5758105 |
tatctcacctttcacaatgttagtttcattttgttttcattttctctgtaatatgcaagagggagtaaatcttttttttgtgaaaatcactttctagatt |
5758204 |
T |
 |
| Q |
208 |
ataattactataaaatcaaaataaattctcgatctaatagatatattgccaaaccattaacaaaggacaaaagataattcttcta |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5758205 |
ataattactataaaatcaaaataaattctcgatctaatagatatattgccaaaccattaacaaaggccaaaagataattcttcta |
5758289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University