View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13457_low_4 (Length: 263)
Name: NF13457_low_4
Description: NF13457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13457_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 6 - 249
Target Start/End: Original strand, 8777485 - 8777730
Alignment:
| Q |
6 |
catagggttttgtttctcttgcgaggannnnnnnnctgggtggaagtaagtcaataaatttatgttcacataatttcctgtattaatgattattttcgtg |
105 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8777485 |
catagggttttgtttctcttgcgaggattttttttctgggtggaagtaagtcaataaatttatgttcacataatttcctgtattaatgattattttcgtg |
8777584 |
T |
 |
| Q |
106 |
acatggcataaacttttgatgcaattccctagattattgtagagttttatttggtgcattgtttcataactcaacttttgatgtttttgtatcgaacaca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8777585 |
acatggcataaacttttgatgcaattccctagattattgtacagttttatttggtgcattgtttcataattcaacttttgatgtttttgtatcgaacaca |
8777684 |
T |
 |
| Q |
206 |
gataaata--tgagtttcatgtatacatctgctaattgttgtgaat |
249 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8777685 |
gataaatatgtgagtttcatgtatacatctgctaatcgttgtgaat |
8777730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 134 - 185
Target Start/End: Original strand, 8790472 - 8790523
Alignment:
| Q |
134 |
ctagattattgtagagttttatttggtgcattgtttcataactcaacttttg |
185 |
Q |
| |
|
|||||||||| || |||||| |||||||||||||||||||| ||||| |||| |
|
|
| T |
8790472 |
ctagattattctacagttttgtttggtgcattgtttcataattcaacatttg |
8790523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 4 - 90
Target Start/End: Complemental strand, 2540388 - 2540302
Alignment:
| Q |
4 |
agcatagggttttgtttctcttgcgaggannnnnnnnctgggtggaagtaagtcaataaatttatgttcacataatttcctgtatta |
90 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| || ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2540388 |
agcatagggttttgtttctcttgcgaggattttttttctggttgcaagtaagtcgataaatttatgttcacataatttcctgtatta |
2540302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University