View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13458_high_2 (Length: 346)
Name: NF13458_high_2
Description: NF13458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13458_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 8 - 330
Target Start/End: Complemental strand, 33542294 - 33541966
Alignment:
| Q |
8 |
cgaagaatattgatgcccctaaactttgcaagcacaaacgaattctaatagacttttctttgggtgttcatcttgtcagataatttattttctatgttct |
107 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33542294 |
cgaaaaatatcgatgcccctaaactttgcaagcacaaacgaattctaatagacttttctttgggtgttcatcttgtcagataatttattttctatgttct |
33542195 |
T |
|
| Q |
108 |
ttttcaatgattgattttta---------agcagatgcatcttcactattgaatgtggaagtgtgacctagtagatggagaaaattaggtttcacggacc |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33542194 |
ttttcaatgattgatttttatcatttcaaagcagatgcatcttcactattgaatgtggaagtgtgacctagtagatggagaaaattaggtttcacggacc |
33542095 |
T |
|
| Q |
199 |
aaatctggtttatgttttgtgtcttttttcccttatccggagaagaattataacaccccatgttttagttatannnnnnngttaagtcatttgcgagtct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33542094 |
aaatctggtttatgttttgtgtcttttttcccttatccggagaagaattataacaccccatgttttagttata---ttttgttaagtcatttgcgagtct |
33541998 |
T |
|
| Q |
299 |
atgtcatatttgatagatgtttggatacttat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33541997 |
atgtcatatttgatagatgtttggatacttat |
33541966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University