View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_high_144 (Length: 335)

Name: NF1345_high_144
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_high_144
NF1345_high_144
[»] chr4 (2 HSPs)
chr4 (1-86)||(49244582-49244667)
chr4 (149-186)||(49244738-49244775)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 49244582 - 49244667
Alignment:
1 aatgttgaacgtgaaagaaggaacaaattgaagcaaatgttcactcacctcactaccactgtccctactctccaccccaatgttaa 86  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49244582 aatgttgaacgtgaaagaaggaacaaattgaagcaaatgttcactcacctcactaccactgtccctactctccaccccaatgttaa 49244667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 149 - 186
Target Start/End: Original strand, 49244738 - 49244775
Alignment:
149 atcgacccattatagcttgatttgttatctgaaatggg 186  Q
    ||||||||||||||| ||||||||||||||||||||||    
49244738 atcgacccattatagtttgatttgttatctgaaatggg 49244775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University