View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_157 (Length: 318)
Name: NF1345_high_157
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_157 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 93 - 225
Target Start/End: Original strand, 7502060 - 7502192
Alignment:
| Q |
93 |
tcagaactgcatgaagaaaccaagaaaaagggaactctttagtttaccaannnnnnnnccatgacactagacgtcactttccccgcccggtgcttgcttc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7502060 |
tcagaactgcatgaagaaaccaagaaaaagggaactctttagtttaccaattttttttccatgacactagacgtcactttccccgcctggtgcttgcttc |
7502159 |
T |
 |
| Q |
193 |
tgcacttgttcttccgacgaccactgctataac |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7502160 |
tgcacttgttcttccgacgaccactgctataac |
7502192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 7501969 - 7502024
Alignment:
| Q |
1 |
cctgaggcttggtctaccccttaaaagaatgacctttatcatactaacatgaagct |
56 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7501969 |
cctgaggcttggtctgccccttaaaagaatgacctttaacatactaacatgaagct |
7502024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 151 - 205
Target Start/End: Complemental strand, 8139653 - 8139599
Alignment:
| Q |
151 |
ccatgacactagacgtcactttccccgcccggtgcttgcttctgcacttgttctt |
205 |
Q |
| |
|
||||||||||||| || |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
8139653 |
ccatgacactagatgtgactttccctgcccggcacttgcttctgcacttgttctt |
8139599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University