View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_167 (Length: 303)
Name: NF1345_high_167
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_167 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 144 - 303
Target Start/End: Original strand, 4709249 - 4709408
Alignment:
| Q |
144 |
tgtgttttggcggtgttaacatttcactgggtgaccttatctacttcgaatgtatttgattgttttaatttttgggttaactatacctacgactaatact |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4709249 |
tgtgttttggcggtgttaacatttcactgggcgaccttatatacttcaaatgtatttgattgttttaatttttgggttaactatacctacgactaatact |
4709348 |
T |
 |
| Q |
244 |
tttctccataggtatagcttttctatacctacgatttaaaatccgtcactataaacctcc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4709349 |
tttctccataggtatagcttttctatacctactatttaaaatccgtcactataaacctcc |
4709408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University