View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_175 (Length: 296)
Name: NF1345_high_175
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_175 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 112 - 283
Target Start/End: Complemental strand, 3780058 - 3779887
Alignment:
| Q |
112 |
cttaatgatgtcttattttatatatgaaatattcacacgnnnnnnngaagaagtttaagcatttttt-aagaagatatttaggaattttattatcaactt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3780058 |
cttaatgatgtcttattttatatatgaaatattcacacgaaaaaa-gaagaagtttaagcatttttttaagaagatatttaggaattttattatcaactt |
3779960 |
T |
|
| Q |
211 |
tgatatgctctcgatgttgtagcatttggataactcctacgcatctcttcgacttttattaaacatacaacct |
283 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3779959 |
tgatatgctctcaatgttgtagcatttggataactcctacgcatctcttcgacttttattaaacatataacct |
3779887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University