View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_176 (Length: 295)
Name: NF1345_high_176
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_176 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 9 - 107
Target Start/End: Complemental strand, 41130843 - 41130745
Alignment:
| Q |
9 |
ttttaataattatattgatcgatctgtccttttatctttaaccttcatgtttctaagaaaaggatattggtgatccaaattttagtcggaaggtaaatt |
107 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41130843 |
tttttataattatattgatcgatttgtccttttatctttaaccttcatgtttctaagaaaaggatattggtgatccaaattttagtcggaaggtaaatt |
41130745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 175 - 282
Target Start/End: Complemental strand, 41130682 - 41130575
Alignment:
| Q |
175 |
gttctcctgaataatttatcgttgttattgatttattccgannnnnnnnaaatttcacttatattattagtttccttttcaattttatgggtttggcatg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41130682 |
gttctcctgaataatttatcgttgttattgatttattccgaaattttttaaatttcacttatattattagtttccttttcaattttatgggtttggcatg |
41130583 |
T |
|
| Q |
275 |
tgcaacag |
282 |
Q |
| |
|
|||||||| |
|
|
| T |
41130582 |
tgcaacag |
41130575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University