View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_184 (Length: 282)
Name: NF1345_high_184
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_184 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 30 - 254
Target Start/End: Complemental strand, 29103539 - 29103317
Alignment:
| Q |
30 |
gattgatcacttgtaatatgatttgcatgcctggcaacattattaacatattgctccccaacttttggagcaatcactgtactcttcttgaatatacggc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103539 |
gattgatcacttgtaatatgatttgcatgcctggcaacattattaacatattgctccccaatttttggagcaatcactgtactcttcttgaatatacggc |
29103440 |
T |
 |
| Q |
130 |
aaagagcatatgcatcctgaaatcacaannnnnnncaatcaaacattttattctctatcaatggatcgataaaaatttctctttcattaaatttactaaa |
229 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103439 |
aaagagcatatgcatcctgaaatcaaaatttttttcaatcaaacattttattctctatcgatggatcgataaaaatttctctttcattaaatttactaaa |
29103340 |
T |
 |
| Q |
230 |
aataatagagtctatcgatggaccg |
254 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
29103339 |
aataat--agtctatcgatggaccg |
29103317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 70 - 149
Target Start/End: Original strand, 32789277 - 32789356
Alignment:
| Q |
70 |
tattaacatattgctccccaacttttggagcaatcactgtactcttcttgaatatacggcaaagagcatatgcatcctga |
149 |
Q |
| |
|
||||| ||||||| | ||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
32789277 |
tattaccatattgtcctccaacttttggcacaatcactgtactcttcttgatcacacggcaaagagcatatgcatcctga |
32789356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University