View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_192 (Length: 275)
Name: NF1345_high_192
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_192 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 3030825 - 3031013
Alignment:
| Q |
1 |
cccctacaaattattatggtagtaaatatgatgacatggagatatttgacactcagatagtttctttatggaacttctcaatttgacacgcttcactatt |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3030825 |
cccctacaaattattatggtagtaactatgatgacatggagatatttgacactcagatagtttctttgtggaacttctcaatttgacacgcttcactatt |
3030924 |
T |
 |
| Q |
101 |
attggatgtggatgattttgtaaaacttttgttctagt---------tagataggtactcatttgttatagaaaattgctaaagagcac |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3030925 |
attggatgtggatgattttgtaaaacttttgttctagttaggtttgctagataggtactcatttgttatagaaaattgctaaagagcac |
3031013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University