View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_201 (Length: 263)
Name: NF1345_high_201
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_201 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 42 - 243
Target Start/End: Complemental strand, 32539604 - 32539403
Alignment:
| Q |
42 |
attgccatgtagagttgagcacaagcagagagatgagaatttggtattccacatgttgttgcaacttgtaaactattggaatttaattctgcaattatgg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539604 |
attgccatgtagagttgagcacaagcagagagatgagaatttggtattccgcatgttgttgcaacttgtaaactattggaatttaattctgcaattatgg |
32539505 |
T |
 |
| Q |
142 |
ttaaaagctcaattgaattcctcaaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcagtttcat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32539504 |
ttaaaagctcaattgaattcctcaaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcaatttcat |
32539405 |
T |
 |
| Q |
242 |
ct |
243 |
Q |
| |
|
|| |
|
|
| T |
32539404 |
ct |
32539403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University