View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_202 (Length: 262)
Name: NF1345_high_202
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_202 |
 |  |
|
| [»] scaffold0065 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0065 (Bit Score: 133; Significance: 3e-69; HSPs: 3)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 93 - 249
Target Start/End: Complemental strand, 49953 - 49797
Alignment:
| Q |
93 |
agttgcagagtgatcagtttgagagtaggaaaagcatggtatactcttggtagtatacatacatattaaccattggataggactaaaatgtaattacgtc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49953 |
agttgcagagtgatcagtttgagagtaggaaaagcatggtatactcttggtaatatacatacatattaaccattggataggaaaaaaatgtaattacgtc |
49854 |
T |
 |
| Q |
193 |
ttagaaaaatgattaagttaattgaccaatagtgggaaagatcacatggccctgtct |
249 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49853 |
ttagaaaaattatcaagttaattgaccaatagtgggaaagatcacatggcactgtct |
49797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 88 - 129
Target Start/End: Complemental strand, 44830 - 44789
Alignment:
| Q |
88 |
ttgaaagttgcagagtgatcagtttgagagtaggaaaagcat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44830 |
ttgaaagttgcagagtgatcagtttgagagtaggaaaagcat |
44789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 44745 - 44701
Alignment:
| Q |
205 |
ttaagttaattgaccaatagtgggaaagatcacatggccctgtct |
249 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44745 |
ttaatttaattgaccaatagtgggcaagatcacatggccctgtct |
44701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 75
Target Start/End: Complemental strand, 13790673 - 13790633
Alignment:
| Q |
35 |
cagcaacagcatatggaatttgctcggccatctttcaaaaa |
75 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
13790673 |
cagcaacagcatatggaatttgctcagccatccttcaaaaa |
13790633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 76
Target Start/End: Original strand, 3174068 - 3174110
Alignment:
| Q |
34 |
gcagcaacagcatatggaatttgctcggccatctttcaaaaat |
76 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
3174068 |
gcagcaacagcatatggaatttgctcagccattcttcaaaaat |
3174110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 73
Target Start/End: Original strand, 3283205 - 3283243
Alignment:
| Q |
35 |
cagcaacagcatatggaatttgctcggccatctttcaaa |
73 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
3283205 |
cagcaacagcgtatggaatttgctcggccatccttcaaa |
3283243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University